Amersham Biosciences Genequant Pro Spectrophotomer Reader Calculator Genequantpro (398% similar) All returned products must be 100% complete in the original packaging, resalable condition, and include any manuals, warranty cards, other accessories All orders will be processed and shipped within 1 business day from receipt of paymentGenequant pro because this was the main equipment that we used for quantification of RNA and we had not recorded the outcome of the quantification In the new version, we have included quantification that had also been done for a few samples using the NanoDrop® (Thermo Scientific) The quantification outcome which demonstratesGrowth kinetics of G parasuis HS069 and HS069Δcap were evaluated using a GeneQuant Pro spectrophotometer (Amersham PLC, Little Chalfont, United Kingdom) G parasuis isolates were inoculated from a liquid overnight culture into BHI broth at an OD 600 of 005 The cultures were incubated at 37°C with 5% CO 2 and shaking at 0 rpm
Amersham Biosciences Ge 3649 For Sale Used N A
Genequant pro rna/dna calculator
Genequant pro rna/dna calculator-May 12, 17 · Amersham Bioscience GeneQuant Pro RNA/DNA Calculator Spectrophotometr Features We can assist for packing and shipping () GST Note GST will be added to the final bid price of this item GST will be added to the buyers premiumULTROSPEC, NOVASPEC GENEQUANT AND NANOVUE SPECTROPHOTOMETERS Service Training These 5 day service training courses cover basic theory and an introduction to the instruments within the support period (GeneQuant curvy, GeneQuant pro curvy, Ultrpspec500/1100pro) and the current product range (GeneQuant 100, GeneQuant 1300,
Feb 01, · RNA was separated with TRIzol (Takara, Kusatsu, Japan), and the messenger RNA (mRNA) concentrations of the samples were determined using the GeneQuant™ pro RNA/DNA Calculator spectro photo meter (Amersham Biosciences, Pittsburgh, PA, USA) mRNA was reverse transcribed to complementary DNA (cDNA) using PrimeScript™ RT reagent kit with gDNAHomeLaboratory EquipmentOther Lab Equipment Amersham Pharmacia Biotech GeneQuant Pro RNA / DNA Calculator Manufacturer Pharmacia;For the GeneQuant 100/1300 and NanoVue Plus these include a built in printer, bluetooth or SD card accessory The SimpliNano has an optional built in printer The Ultrospec 2100/7000/8000/9000 have a range of accessories that can be fitted in the sample compartment including a sipper, long path length cell holder and thermostatted cell holder
You are bidding on a lot of 1 used Biochrom Ltd Genequant Pro RNA/DNA Spectrophotometer, Model 98and Seiko Instruments Thermal Printer, Model DPUB Spectrophotometer is 110V plug Powers on and preforms start up test Thermal printer powers on and prints, but is out of paper Power cord, AC adapter, and serial cable are includedYopoiesis, the molecular mechanisms controlling this process remain largely unknown A major obstacle for accomplishing this goal has been the difficulty of expanding and purifying a large megakaryocyte (MK) population to Offprint requests to MiHyun Shim, Puget Sound Blood Center, 921 Terry Avenue, Seattle, WA ;Amersham Biosciences GeneQuant Pro DNA/RNA Calculator Spectrophotome ter Please refer to picture for actual item Pickup and inspection is welcome Seller assumes all responsibility for this listing Postage and handling This item can be sent to United States, but the seller has not specified postage options
Apr 01, 21 · The total RNA was extracted from the antennae and legs of 150 flies (male–female ratio, 11) TRIzol Reagent (Invitrogen, Thermo Scientific) was used to isolate total RNA, and RNA quality and quantity were assessed with a spectrophotometer (GeneQuant Pro RNA/DNA calculator, Amersham Biosciences, Cambridge, UK)(List of 474 Instrument Data) How important is the Z dimension?Aug 15, 06 · GeneQuant™ pro RNA/DNA Calculator From GE Healthcare The GE Healthcare (formerly Amersham Biosciences) GeneQuant™ pro RNA/DNA Calculator Spectrophotometer is used in our laboratory primarily to measure RNA, DNA and protein concentrations One of the reasons we use this spectrophotometer is that it can detect as little as ng of DNA
The GE Healthcare GeneQuant pro RNA/DNA Calculator is a small spectrophotometer with a wavelength range of 230 600 nmJun , 1999 · That seems to be the thinking behind the GeneQuant pro from Amersham, a spectrophotometer designed specifically for the molecular biology laboratory No fullrange spectrophotometer with UVvis crossover, this instrument uses just the essential wavelengths needed for molecular biology 230, 260, 280, 3, 595, and 600 nmDec 22, 17 · Quantification of the extracted RNA was done using the microspectrophotometer Genequant pro (Amersham Pharmacia Ltd, Bucks, UK) and a few samples were quantified using the NanoDrop ® (Therm Scientific) In addition, DNaseI digestion was carried out to remove any residual DNA that could present in the extracted RNA
Jun 07, 16 · Amersham GeneQuant Pro Spectrophotometer, S/N ALL EQUIPMENT IS SOLD AS IS, WHERE IS LOAD OUT FEE @ $100 ASSET LOCATION IRVINE, CA NOTE REMOVAL WILL BEGIN ON JULY 25th BY SCHEDULED APPOINTMENT ONLYUniversal Resource Trading Ltd Amersham Pharmacia Biotech GeneQuant Pro RNA/DNA Calculator This unit was removed from a lab as surplus to requirements The unit powers up but we have not tested it further Accessories Grade Grade Condition Function 1 New or As New New or As New 2 Used, in excellent condition Item has been tested and is working 3 Used, in good condition butOct 19, · RNA was eluted in μl of elution buffer RNA concentration and purity were assessed using a Genequant Pro Spectrophotometer (GE Healthcare UK Ltd, Buckinghamshire, UK), and RTPCR was performed using the HighCapacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA)
Find nullGE MSDS, related peerreviewed papers, technical documents, similar products & more at SigmaAldrichThis unit was removed from a lab as surplus to requirements The unit powers up but we have not tested it furtherPicClick Insights Amersham Biosciences GeneQuant Pro DNA/RNA Calculator Spectrophotometer PicClick Exclusive Popularity 3,3 views, 29 views per day, 1,1 days on eBay Super high amount of views 0 sold, 1 available
Dec 28, 18 · You are bidding on 1 used Genequant Pro 90 Unit has been cleaned and tested for power only and does power on No further testing was preformed Unit includes power and data cables and dust cover Unit appears to be in good condition and fully functional, but may have hidden defects and is sold as isAnd ERIC1R (5′ATGTAAGCTCCTGGGGATTCAC3′), ERIC2 (5′AAGTAAGTGACTGGGGTGAGCG3′) PCR reaction mixtures were prepared by usingBuy new lab equipment We supply a wide range of brand new equipment for the laboratory pH, petroleum product testers, freezers, furnaces, microscopes and more
With the GeneQuant Pro (Amersham Biosciences, UK) at 595nm Cellular protein was calculated from the standard curve equation and the appropriate volumes of supernatant samples were measured quantitatively in order to achieve equal loading ofMay 01, 12 · The RNA and cDNA of each sample were analysed using a GeneQuant pro DNA/RNA Calculator to assess the concentrations and purity The cDNA samples were stored at − °C until use Quantitative realtime PCR was performed by applying the realtime SYBR Green PCR technology with the use of a 7300 RealTime PCR System (Applied Biosystems, FosterYour GeneQuant pro RNA/DNA Calculator is a unique, yet simple to use spectrophotometer designed specifically for molecular biologists working in the life sciences, including biotechnology and drug discovery research It has a pulsed deuterium borosilicate glass lamp for long life It measures absorbance at 230, 260,
Serial Number Decal Model No PFTL490 USER'S MANUAL Serial No CAUTION Read all precautions and instructions in this manual before using this equipment Save this manualGeneQuant pro (Biochrom Ltd, Cambridge, UK) spectrophotometer Two primer pairs were used for the amplification reactions (7) REP1RI (5′IIIICGICGICATCIGGC3′), REP2I (5′ICGICTTATCIGGCCTAC3′);UcfDNA was extracted from urine samples by a spin columnbased method and quantified using four different methods GeneQuant Pro (Amersham Biosciences, Pittsburg, PA, USA), QuantiT™ DNA highsensitivity assay kit (Invitrogen, Carlsbad, CA, USA), RealTime PCR (Applied Biosystems, Foster City, CA, USA), and NanoDrop 1000 (NanoDrop Technologies, Houston, TX, USA)
The GeneQuant proRNA/DNA Calculator is a "mini" spectrophotometer It is designed to meet the needs of molecular biologists making discrete nucleic acid (DNA, RNA, and oligonucleotide primers), protein, and bacterial cell culture measurements in genetic and proteome analysis, biotechnology laboratories, and drug discovery researchJun 06, 07 · The GeneQuant prohas a new, sleek design and can be ordered in a variety of colors The machine came packaged well and was very easy to install It was ready to use almost instantly The machine should be placed on a solid surface, but only requires about one square foot of spaceContact Technical Support If you have a general installation question, please read our FAQDo you need help on how to use the software?
UcfDNA was extracted from urine samples by a spin columnbased method and quantified using four different methods GeneQuant Pro (Amersham Biosciences, Pittsburg, PA, USA), QuantiT DNA highsensitivity assay kit (Invitrogen, Carlsbad, CA, USA), RealTime PCR (Applied Biosystems, Foster City, CA, USA), and NanoDrop 1000 (NanoDrop Technologies, Houston, TX, USA)The GE Healthcare / Amersham Biosciences Ultrospec 3100 pro UV/Visible spectrophotometer is the ideal instrument for the modern, yet demanding, life science laboratory where bench space is at a premium It is available in a range of colors classic, yellow, plum, apple and has both exciting styling and design (registered design protectionA compact instrument with a range of stored life science methods and standard spectroscopic applications Proteins and nucleic acids GeneQuant 100 A compact instrument with a range of stored methods for the quantitation of proteins, nucleic acids, and bacterial cell cultures
GeneQuant 1300 is designed to measure the concentration and purity of nucleic acid and protein samples and the density of bacterial cell cultures at a broad range of sample volumes It can be used with a variety of cuvettes for sample volumes 3 µlAmersham Biosciences GeneQuant pro Spectrophotometer UV/Vis Reader Used US Seller "The sale of this item may be subject to regulation by the US Food and Drug Administration and state and local regulatory agencies For all others, there will be extra Fixed Price $Ge GeneQuant 1300 Pdf User Manuals View online or download Ge GeneQuant 1300 Original Instructions Manual
GE Deuterium lamp assembly for GeneQuant PRO;The total RNA was extracted from the antennae and legs of 150 flies (male–female ratio, 11) TRIzol Reagent (Invitrogen, Thermo Scientific) was used to isolate total RNA, and RNA quality and quantity were assessed with a spectrophotometer (GeneQuant Pro RNA/DNA calculator, Amersham Biosciences, Cambridge, UK)Spectrophotometry is a branch of electromagnetic spectroscopy concerned with the quantitative measurement of the reflection or transmission properties of a material as a function of wavelength Spectrophotometry uses photometers, known as spectrophotometers, that can measure the intensity of a light beam at different wavelengthsAlthough spectrophotometry is most commonly
Plus, GeneQuant 100/1300 and NanoVue Plus units have the on/off switch on the keypad • Ultrospec 2100/3100/5300/6300 units have an on/off switch on the back of the instrument on the right hand side • Ultrospec 7000/8000/9000 instruments have the on/off switch on the left hand side of the instrumentIQUANTpro is an Internet based publication (the "Site") and is not affiliated with an investment advisor or Broker/Dealer Neither iQUANTpro nor the Site is registered as an investment adviser with any federal or state regulatory agency, or in any other regulatory capacity To the extent that any portion of the Site content would need toApr 28, 10 · The supernatant was discarded, and the resulting pellet was washed with 75% ethanol, air dried, and redissolved in diethylpyrocarbonatetreated water Total RNA was determined using a GeneQuant Pro spectrophotometer measuring absorbance at 260/280 nm (Amersham Pharmacia Biotech, Uppsala, Sweden)
GeneQuant Pro Curvy RNA/DNA Calculator Spectrophotometer W WARRANTYGE Healthcare Original List Price $4,441This is a Nice Used Good Working GeneQuant Pro CurvyJun 27, 19 · To assess cell concentration, the OD 600 of a tenfold dilution from each culture broth was measured with a GeneQuant Pro RNA/DNA calculator spectrophotometer (GEDOTmedcom is a medical and hospital equipment classified advertising site for new and used medical equipment for sale or wanted, we also list refurbished medical equipment We also offer a
GeneQuant Pro RNA/DNA Calculator Spectrophotometer $ $3500 shipping Amersham Biosciences Ultrospec 3100 Pro Spectrophotometer~ For PARTS/ REPAIR $ shipping Pharmacia GeneQuant II Spectrophotometer Genequant RNA/DNA $Feb 09, 11 · To perform RepPCR chromosomal profiling, genomic DNA was extracted from bacteria by using High Pure PCR Template Preparation Kit (Roche Diagnostics GmbH, Mannheim, Germany) and quantified by using a GeneQuant pro (Biochrom Ltd, Cambridge, UK) spectrophotometerWhen using an ultra micro volume cuvette, it is important that your sample solution is placed in